haplogroup g origin haplogroup g origin

The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. We attempted to localize the potential geographic origin of . Kivisild T, Rootsi S, Metspalu M et al. Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. Haplogroup G is a branch on the maternal tree of human kind. Proc Natl Acad Sci USA 2011; 108: 1825518259. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. To obtain Two additional markers, DYS38829, 30 and DYS46131 were typed separately. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. Its chromosome location listed as 21653414. Whatever the date or specific place of origin, part of the G family put down roots predominantly in the area south and east of the Caucasus mountains. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. The number of STR marker values separating men in this group suggest G-PF3359 is a relatively old group despite the small number of men involved. Hum Genet 2004; 114: 127148. . Forensic Sci Int-Gen 2007; 1: 287290. Iceman tzi, known to have been a haplogr. The Etruscans: a population-genetic study. In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent. Google Scholar. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. It was found with burial artifacts belonging to the Linearbandkeramische Kultur ("Linear Band Ceramic Culture"; LBK). In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. The Turkish G-M377 is somewhat closer, but not identical. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. G-M377, now also known as G2b1, has previously been designated G2b and G2c. Kaniewski D, Van Campo E, Van Lerberghe K et al. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. In the G2a3b-P303 network (Figure 4), there are several region-specific clusters, indicating a considerable history for this SNP. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). The genome-wide structure of the Jewish people. The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Peter A Underhill. Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. No clinal patterns were detected suggesting that the distributions are rather indicative of isolation by distance and demographic complexities. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. You are using a browser version with limited support for CSS. It is provided at the request of readers. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. PAU thanks Professor Carlos D Bustamante. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. Mol Phylogenet Evol 2007; 44: 228239. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. No labs have yet assigned them shorthand names. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE.